|
Virtual Experiment
You have experimentally sequenced a random clone from a cDNA library of
Arabidopsis. Please find potential candidates for these genes using blastn
Protocol for gene 1:
- Go to
The blast server at NASC
- DO NOT change any of the choices.
- Read all of the text
- Note the differences between the blast programs
Now - put the following DNA sequence into the appropriate box and perform a blast search
GAAGCATACTGTGACATGTTGGTTAAATATCGTGAGGAGCTAA
CAAGGCCCATTCAGGAAGCAATGGAGTTTATACGTCGTATTGA
ATCTCAGCTTAGCATGTTGTGTCAGAGTCCCATTCACATCCTCA
Wait for a match to appear
What is the chromosome position of the top match ?
Type it here:
What is its 'E-value'? :
What is the chromosome position of the next highest match ?
Type it here:
What is its 'E-value'? :
'Mouse over' the best match on the chromosome view.
Use the dropdown for the best match to see the ContigView (context).
What is the title of the gene ? :
SO what is an E-value and what does Blast do ?
Please find some answers here
Now, knowing the procedure please repeat for this sequence:
GTAGGCTGTAACGCTTTATCACTTCTGGACACTTTTGGAATGCAAAACTACTCAACTGC
ATGCTTGTCATTATGCGATTCTCCCCCAGAGGCTGATGGAGAATGTAATGGTAGAGGTT
What is the chromosome position of the top match ?:
What is its 'E-value'? :
What is the chromosome position of the next highest match ?
What is its 'E-value'? :
In the contigview, what is the title of the gene ? :
Protocol for part two:
- Please - go to The EBI
Note, the default setting for program is different to the one you used above.
Change the program to be the same as the default that you used for DNA
- blastn the sequence of the gene(s) (from above) again.
Gene 1: EMBL accession number using EBI
Gene 1: E-value using EBI
Gene 2: EMBL accession number using EBI
Gene 2: E-value using EBI
Are the answers the same when comparing EBI and AtEnsembl (above) ? Would you expect this ? Why ?
Please answer the following questions (briefly) using the help files at any of the links above (or Google):
What is blastp, how does it differ to blastn ?
What is blastX ?
What is TblastX ?
With the following protein sequence, please find a match using blastp at EBI
IF the search fails, reconsider the database that you are searching
and how BLASTp differs from BLASTn. Retry the search.
What is the name and proposed gene function that is conserved between
the best matches ?
|